View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11982A_low_501 (Length: 222)
Name: NF11982A_low_501
Description: NF11982A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11982A_low_501 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 7 - 219
Target Start/End: Original strand, 21830644 - 21830856
Alignment:
| Q |
7 |
tttcttgattgttgtttttgttctcgaattttttcgtgatggcgcggctaataacaatgctagtggctttaagattctctttattttcatctaatcccat |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||| |
|
|
| T |
21830644 |
tttcttgattgttgtttttgttctcgaattttttcgtgatggcgcggctaataacaatgctagtagctttaagattctctttattttcatccaatcccat |
21830743 |
T |
|
| Q |
107 |
acttccaagcaatcttcgtcttctttccgtgatggatcccggagcagccatccatatatcatagttaggagcaatgccggtagccgggggaagctccggc |
206 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
21830744 |
acttccaagcaatcttcgtcttctttctgtgatagatcccggagcagccatccatatatcatagtttggagcaatgccggtagccgggggaagctccggc |
21830843 |
T |
|
| Q |
207 |
ttccggtgtttgg |
219 |
Q |
| |
|
||||||||||||| |
|
|
| T |
21830844 |
ttccggtgtttgg |
21830856 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University