View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11982A_low_503 (Length: 222)
Name: NF11982A_low_503
Description: NF11982A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11982A_low_503 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 18 - 210
Target Start/End: Original strand, 30492207 - 30492399
Alignment:
| Q |
18 |
aacatccaagtacatggttattgaagttgacattatggctactatctacatggtttggcacattgattttgtgtggtattgcatgtatctcaacaaaatt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
30492207 |
aacatccaagtacatggttattgaagttgacattatggctactatctacatggtttggcacattgattttgtgtggtattgcaagtatctcaacaaaatt |
30492306 |
T |
 |
| Q |
118 |
cccatttttccatagctaccctaagttgtctccagagaaacgccaaaaagtgatgatgtcttggtctgtaagttaccttcgtcctcttagaat |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30492307 |
cccatttttccatagctaccctaagttgtctccagagaaacgccaaaaagtgatgctgtcttggtctgtaagttaccttcgtcctcttagaat |
30492399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University