View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11982A_low_505 (Length: 220)
Name: NF11982A_low_505
Description: NF11982A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11982A_low_505 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 20 - 180
Target Start/End: Complemental strand, 41223205 - 41223051
Alignment:
| Q |
20 |
aaaatactcagagggagagatttgatccctttgtgatcctatccggttcgagtaattagtctctgcagtcgtgcgcagaggcaggatattgattcacatt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||| |||| ||||| ||||||||||| |
|
|
| T |
41223205 |
aaaatactcagagggagagatttgatcc-tttgtgatcctatccggttcgaggaattagtctctgcagtcgtgcgcaaaggctggatactgattcacatt |
41223107 |
T |
|
| Q |
120 |
aaaaaggagttcaattcaattcaatagaatttttcgattctatgtcttcggaactatattc |
180 |
Q |
| |
|
|||||||||||||||| ||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
41223106 |
aaaaaggagttcaatt-----caatagaattttttgattctatgtcttcggaactatattc |
41223051 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University