View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11982A_low_511 (Length: 218)
Name: NF11982A_low_511
Description: NF11982A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11982A_low_511 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 154; Significance: 7e-82; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 22 - 218
Target Start/End: Complemental strand, 38093126 - 38092934
Alignment:
| Q |
22 |
caatatattcaaggaaattttgcaacaagaacaaatattcctggatcccacaatttgaatgaagatcttgttctcatagacgtatcaaattgtccgaagg |
121 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
38093126 |
caatatattcaaggaaattttgcaactagaacaaatattcgtggatcccacaatttgaatgaagatcttgttctcatagacgtatcgaattgtccgaagg |
38093027 |
T |
|
| Q |
122 |
aatcccattgtttccttttt-ccaatatttctcattcaagaaaacaacatatagggtttctttccttctgcaccctttgagtcaattctgcatgcttt |
218 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
38093026 |
aatcccattgtttccttttttccaatatttctcattcaagaaaacaacatatagggtttcttg-----tgcaccctttgagtcaattctgcatgcttt |
38092934 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University