View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11982A_low_519 (Length: 215)
Name: NF11982A_low_519
Description: NF11982A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11982A_low_519 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 215
Target Start/End: Complemental strand, 20489881 - 20489671
Alignment:
| Q |
1 |
atactaagtatgcatgtgtagttcttaaagttgtttgcactggaaaaggctactctaccattatcctttgctccattggtgggacttcatgacatatgac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20489881 |
atactaagtatgcatgtgtagttcttaaagttgtttgcactggaaaaggctactctaccattatcctttgctccattggtgggacttcatgacatatgac |
20489782 |
T |
|
| Q |
101 |
gtaccttccttgatgatacttaaagaaaaatttgaagatttacatgacaagacattttctatctattaatattaattatactaatctatatttctactat |
200 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20489781 |
----cttccttgattttacttaaagaaaaatttgaagatttacatgacaagacattttctatctattaatattaattatactaatctatatttctactat |
20489686 |
T |
|
| Q |
201 |
tacagctaattactt |
215 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
20489685 |
tacagctaattactt |
20489671 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University