View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11982A_low_523 (Length: 214)
Name: NF11982A_low_523
Description: NF11982A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11982A_low_523 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 20 - 197
Target Start/End: Original strand, 12913908 - 12914085
Alignment:
| Q |
20 |
ttcttccttttgcggcgacggcgagagctctgtcagcggcttcacggactgccttgcctcgacgaggccctccagtggtgccgccgatgtttactctcgc |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||| || |
|
|
| T |
12913908 |
ttcttccttttgcggcgacggcgagagctctgtcagcggcttcacggacggccttgcctcgacgaggccctccagtggtgccgccgatgttgactcttgc |
12914007 |
T |
 |
| Q |
120 |
cagagcctggtggagtttagaagagtagatttgttgttgggcttgtgatctccatttggcgcggctattttctctctg |
197 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||| |||||||| || ||||||||||||||||| |
|
|
| T |
12914008 |
cagagcctggtggagtttggaagagtagatttgttgttgggcttgtgacctccatttagcacggctattttctctctg |
12914085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University