View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11982A_low_526 (Length: 212)

Name: NF11982A_low_526
Description: NF11982A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11982A_low_526
NF11982A_low_526
[»] chr2 (2 HSPs)
chr2 (7-212)||(13960417-13960622)
chr2 (119-212)||(13967581-13967674)
[»] chr4 (1 HSPs)
chr4 (106-204)||(49870992-49871090)
[»] scaffold0618 (1 HSPs)
scaffold0618 (167-207)||(6835-6875)
[»] chr8 (3 HSPs)
chr8 (167-207)||(44067730-44067770)
chr8 (167-207)||(44087534-44087574)
chr8 (167-207)||(44093036-44093076)


Alignment Details
Target: chr2 (Bit Score: 202; Significance: 1e-110; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 7 - 212
Target Start/End: Complemental strand, 13960622 - 13960417
Alignment:
7 tagtgcacctgtgaaatgacaactttggaaaacaaagccacttgagctgtcggatttggttcttccatcggcagctacgaaacattgttgttcttctaat 106  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
13960622 tagtgcacctgtgaaatgacaactttggaaaacaaagccacttgagctgtcagatttggttcttccatcggcagctacgaaacattgttgttcttctaat 13960523  T
107 ggttttcttacgattagtttgcagttttggaaaactgcaaaggcgtcaccgtagatcatgtcgattgtgccagagatgctgcagtcacggtagaattgac 206  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13960522 ggttttcttacgattagtttgcagttttggaaaactgcaaaggcgtcaccgtagatcatgtcgattgtgccagagatgctgcagtcacggtagaattgac 13960423  T
207 gttggg 212  Q
    ||||||    
13960422 gttggg 13960417  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 119 - 212
Target Start/End: Complemental strand, 13967674 - 13967581
Alignment:
119 attagtttgcagttttggaaaactgcaaaggcgtcaccgtagatcatgtcgattgtgccagagatgctgcagtcacggtagaattgacgttggg 212  Q
    ||||||||||| |||||||||||| |||||||||| ||  | |  | |||||||||||||||||||  ||||||||||||||||||||||||||    
13967674 attagtttgcaattttggaaaactccaaaggcgtcgccaaaaacaaagtcgattgtgccagagatggcgcagtcacggtagaattgacgttggg 13967581  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 106 - 204
Target Start/End: Original strand, 49870992 - 49871090
Alignment:
106 tggttttcttacgattagtttgcagttttggaaaactgcaaaggcgtcaccgtagatcatgtcgattgtgccagagatgctgcagtcacggtagaattg 204  Q
    ||||||||| ||||| ||||||||||||||||||||| |||  || |||||  |||  | ||||||||| || |  ||| ||||||| |||||||||||    
49870992 tggttttctaacgatgagtttgcagttttggaaaactccaactgcatcaccaaagacaaagtcgattgttccggtaatggtgcagtcgcggtagaattg 49871090  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0618 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0618
Description:

Target: scaffold0618; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 167 - 207
Target Start/End: Complemental strand, 6875 - 6835
Alignment:
167 tcgattgtgccagagatgctgcagtcacggtagaattgacg 207  Q
    |||||||| ||| ||||| ||||||||||||||||||||||    
6875 tcgattgttccatagatgttgcagtcacggtagaattgacg 6835  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 167 - 207
Target Start/End: Original strand, 44067730 - 44067770
Alignment:
167 tcgattgtgccagagatgctgcagtcacggtagaattgacg 207  Q
    |||||||| ||| ||||| ||||||||||||||||||||||    
44067730 tcgattgttccatagatgttgcagtcacggtagaattgacg 44067770  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 167 - 207
Target Start/End: Complemental strand, 44087574 - 44087534
Alignment:
167 tcgattgtgccagagatgctgcagtcacggtagaattgacg 207  Q
    |||||||| ||| ||||| ||||||||||||||||||||||    
44087574 tcgattgttccatagatgttgcagtcacggtagaattgacg 44087534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 167 - 207
Target Start/End: Original strand, 44093036 - 44093076
Alignment:
167 tcgattgtgccagagatgctgcagtcacggtagaattgacg 207  Q
    |||||||| ||| ||||| ||||||||||||||||||||||    
44093036 tcgattgttccatagatgttgcagtcacggtagaattgacg 44093076  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University