View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11982A_low_531 (Length: 211)
Name: NF11982A_low_531
Description: NF11982A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11982A_low_531 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 31 - 183
Target Start/End: Original strand, 49125416 - 49125568
Alignment:
| Q |
31 |
ctctttctttaatttatatatattcattcttgtcaaggtgtgtgtgtctttcttttcttttagctgtagcatatttggtatttgttgcatgcttgacatt |
130 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
49125416 |
ctctttctttaatttatatatattcattcttgtcaaggtgtgtgtgtctttcttttcttttagttgtagcatatttggtatttgttgcatgcttgacatt |
49125515 |
T |
|
| Q |
131 |
atttttatttatgattttacaatgacatagatgagtgagcatgatcatgaagt |
183 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
49125516 |
atttttatttatgattttacaatgacatagatgagtgagcatgatcaagaagt |
49125568 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University