View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11982A_low_534 (Length: 210)
Name: NF11982A_low_534
Description: NF11982A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11982A_low_534 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 18 - 191
Target Start/End: Complemental strand, 2896984 - 2896811
Alignment:
| Q |
18 |
aatattatattatgtagagaaggactatttgtatcaaatcgtgtagtgtgtttggctgattgattcgattctggttgtgtcgatggtaaaataaggttga |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
2896984 |
aatattatattatgtagagaaggactatttgtatcaaatcgtgtagtgtgtttggctgattgattggattctggttgtgtcgatggtaaaataaggttga |
2896885 |
T |
 |
| Q |
118 |
gttttattttccctattgcactaatttgactgaactaatatttaagatcagagaggcccttttaatgggatctt |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2896884 |
gttttattttccctattgcactaatttgactgaactaatatttaagatcagagaggcccttttaatgggatctt |
2896811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University