View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11982A_low_538 (Length: 209)

Name: NF11982A_low_538
Description: NF11982A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11982A_low_538
NF11982A_low_538
[»] chr2 (1 HSPs)
chr2 (19-195)||(45096785-45096961)


Alignment Details
Target: chr2 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 19 - 195
Target Start/End: Complemental strand, 45096961 - 45096785
Alignment:
19 ttcttatgcttggtggtctcagttgcctaaccaaattagagacgattatattagaaatagattaggttttgcaatttacgattttgttagctctttttga 118  Q
    ||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||    
45096961 ttcttatgcttggtggtttcagttgcctaaccaaattagagacgactatattagaaatagattaggttttacaatttacgattttgttagctctttttga 45096862  T
119 gggtttggtcttatatcccattcttttcattgtacctttttagcttatcaatgtattttgggtcttgcttcttctct 195  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
45096861 gggtttggtcttatatcccattcttttcattgtacctttttagcttatcaatgtattttgggtcttgcttcatctct 45096785  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University