View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11982A_low_538 (Length: 209)
Name: NF11982A_low_538
Description: NF11982A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11982A_low_538 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 19 - 195
Target Start/End: Complemental strand, 45096961 - 45096785
Alignment:
| Q |
19 |
ttcttatgcttggtggtctcagttgcctaaccaaattagagacgattatattagaaatagattaggttttgcaatttacgattttgttagctctttttga |
118 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
45096961 |
ttcttatgcttggtggtttcagttgcctaaccaaattagagacgactatattagaaatagattaggttttacaatttacgattttgttagctctttttga |
45096862 |
T |
 |
| Q |
119 |
gggtttggtcttatatcccattcttttcattgtacctttttagcttatcaatgtattttgggtcttgcttcttctct |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
45096861 |
gggtttggtcttatatcccattcttttcattgtacctttttagcttatcaatgtattttgggtcttgcttcatctct |
45096785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University