View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11982A_low_541 (Length: 209)
Name: NF11982A_low_541
Description: NF11982A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11982A_low_541 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 120; Significance: 1e-61; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 19 - 182
Target Start/End: Original strand, 2313098 - 2313261
Alignment:
| Q |
19 |
aaattattgttatttttgtgatttgatgtggattttgattggttgtgctaatgactgttattttgtgattgcaattaagtgactttgatgggtnnnnnnn |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
2313098 |
aaattattgttatttttgtgatttgatgtggattttgattggttgtgctaatgactgttattttgtgattgcaattaagtgactttgaagggttgtgtgt |
2313197 |
T |
|
| Q |
119 |
nnnnnattgaaaatttttgttttacgcaaagtgattaattttgatagtttgtgttgttgatgat |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
2313198 |
gtgtgattgaaaatttttgttttacgcaaagtgattaattttgatagtttgtgttgtagatgat |
2313261 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University