View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11982A_low_542 (Length: 209)
Name: NF11982A_low_542
Description: NF11982A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11982A_low_542 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 115; Significance: 1e-58; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 21 - 185
Target Start/End: Original strand, 42581426 - 42581588
Alignment:
| Q |
21 |
acaggtggcattgtgaacaccgtgttgctgaatgatgctcctactctgggaagtgaatttcattctcttccttcaggtgcttataatgttcattattaat |
120 |
Q |
| |
|
||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42581426 |
acaggtgacattgtgaacaccgtgttgctcaatgatgctcctactctgggaagtgaatttgattctcttccttcaggtgcttataatgttcattattaat |
42581525 |
T |
|
| Q |
121 |
actactgaatatttcatcannnnnnnnnnnattatttctacttctgtattagatttaaaatcact |
185 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
42581526 |
actactgaatatttcatca--tttttttttattatttctacttctgtattagatttaaaatcact |
42581588 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University