View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11982A_low_546 (Length: 207)
Name: NF11982A_low_546
Description: NF11982A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11982A_low_546 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 14 - 194
Target Start/End: Complemental strand, 886009 - 885829
Alignment:
| Q |
14 |
agagaataaatgagaagcaagttggtgtgatttttggagggaatcacaaccaccccattggttcttgatggccatttgaagggcataccaacgtgagaga |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
886009 |
agagaataaatgagaagcaagttggtgtgatttttggagggaatcacaaccaccccattggttcttaatggccatttgaagggcataccaacgtgagaga |
885910 |
T |
 |
| Q |
114 |
agcaaaatgatactctcttgtaacctaatcctagagagtgtttctgtttctctattgatggtatccatcatgagaagaacc |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
885909 |
agcaaaatgatactctcttgtaacctaatcctagagagtgtttctgtttctctattgatggtatccatcatgagaagaacc |
885829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University