View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11982A_low_550 (Length: 205)

Name: NF11982A_low_550
Description: NF11982A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11982A_low_550
NF11982A_low_550
[»] chr4 (1 HSPs)
chr4 (17-185)||(54978146-54978317)


Alignment Details
Target: chr4 (Bit Score: 154; Significance: 7e-82; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 17 - 185
Target Start/End: Complemental strand, 54978317 - 54978146
Alignment:
17 gcattcatcacgcatcaattcagagtcacaaccccaaatagcacatctagaactttttgccccggccatatgtggatgcttgtccaaaccgttactcaac 116  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
54978317 gcattcatcacgcatcaattcagagtcacaaccccaaatagcacatctagaactttttgccccggccatatgtggatggttgtccaaaccgttactcaac 54978218  T
117 tttctacgcttatggtt---gtcgaatctttctggcgaatccattggttggttatcaggagttggtggtgtc 185  Q
    |||||||||||||||||   ||||||||||||||||||||||||||||||||||||||||||||||||||||    
54978217 tttctacgcttatggttgcagtcgaatctttctggcgaatccattggttggttatcaggagttggtggtgtc 54978146  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University