View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11982A_low_556 (Length: 203)
Name: NF11982A_low_556
Description: NF11982A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11982A_low_556 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 119; Significance: 5e-61; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 119; E-Value: 5e-61
Query Start/End: Original strand, 26 - 203
Target Start/End: Original strand, 43551937 - 43552115
Alignment:
| Q |
26 |
tgttgcatctgtgtacgtgattcatagtttgtaggctatctcgaatattcatatgatattaaacagctcaaattaaacaataacaaaatcatattcaac- |
124 |
Q |
| |
|
|||||| | ||||| |||| ||||||| ||||||| ||||||| ||||||||||||||||||||| ||||||||||||||||||||||||| |||||| |
|
|
| T |
43551937 |
tgttgcgtatgtgttcgtgcttcataggttgtaggttatctcgtatattcatatgatattaaacacctcaaattaaacaataacaaaatcagattcaatt |
43552036 |
T |
|
| Q |
125 |
aattttaattgttaatttaagatcaaacggttgaaatttaaaatgcatgacaaattttacgaaattcaaatatgtaata |
203 |
Q |
| |
|
|||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
43552037 |
aattttaattgttaatttgagatcacacggttgaaatttaaaatgcatgacaaattttaccaaattcaaatatgtaata |
43552115 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University