View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11982A_low_57 (Length: 393)
Name: NF11982A_low_57
Description: NF11982A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11982A_low_57 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 113; Significance: 4e-57; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 113; E-Value: 4e-57
Query Start/End: Original strand, 117 - 241
Target Start/End: Complemental strand, 23408001 - 23407877
Alignment:
| Q |
117 |
gaaagttcagaggtgagcttagaaggaaagatacatggtgtgtgtttgattctatatccagctaatgctaatatatgaacacattgttcaaactagtaaa |
216 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23408001 |
gaaagttcagaggtgagcttagaaagaaagatacatggtgtgtgtttgattctatatccagctaatgctaatatatgaacacattgttcaaactagtaaa |
23407902 |
T |
 |
| Q |
217 |
tttgttcttggaattggttcatctc |
241 |
Q |
| |
|
||||||||||| |||||||| |||| |
|
|
| T |
23407901 |
tttgttcttggtattggttcttctc |
23407877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University