View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11982A_low_66 (Length: 384)
Name: NF11982A_low_66
Description: NF11982A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11982A_low_66 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 147; Significance: 2e-77; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 22 - 245
Target Start/End: Complemental strand, 44547176 - 44546958
Alignment:
| Q |
22 |
cccccgacattcacacaatcggtgcatcgctaactgttagatgggatcaagatctgaaccatttggtctcgatccaacggttaccgatgggctgactgga |
121 |
Q |
| |
|
|||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44547176 |
cccccgacat-cacacaatcagtgcatcgctaactgttagatgggatcaagatctgaaccatttggtctcgatccaacggttaccgatgggctgactgga |
44547078 |
T |
 |
| Q |
122 |
agcaattgcattcgaatagatagtacatacacatcataaaagaaagataaaatgtggactattagnnnnnnnnnnnnttgacaaatataagattgcatat |
221 |
Q |
| |
|
|||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
44547077 |
agcaatgacattcga----atagtacatacacatcataaaagaaagataaaatgtggactattagaaaaaagaaaaattgacaaatttaagattgcatat |
44546982 |
T |
 |
| Q |
222 |
taccaagctttccacattaattat |
245 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
44546981 |
taccaagctttccacattaattat |
44546958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 310 - 362
Target Start/End: Complemental strand, 44546893 - 44546841
Alignment:
| Q |
310 |
acaaatgtagctttcacagctgaaacaccttcttcctcattcacatcgttctt |
362 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44546893 |
acaaatgtagctttcacagctgaaacaccttcttcctcattcacatcgttctt |
44546841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University