View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11982_high_19 (Length: 347)
Name: NF11982_high_19
Description: NF11982
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11982_high_19 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 312; Significance: 1e-176; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 312; E-Value: 1e-176
Query Start/End: Original strand, 1 - 341
Target Start/End: Complemental strand, 48154286 - 48153940
Alignment:
| Q |
1 |
tgctgcaaaaccgtcctcaacctcactgcttctaccatcatgtccaactc------accctcttcatcttctctatccatggacatagacgaatccatag |
94 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
48154286 |
tgctgcaaaaccgtcctcaacctcactgcttctaccatcatgtccaactccaactcaccctcttcatcttctctatccatggacatagacgaatccacag |
48154187 |
T |
|
| Q |
95 |
aaactcgaatcaaccgcctcatatcagaacaccctgtcatcatcttcacccgatcctcctcatgctgcatgtgccatgtcatgaggaatctcctcttcac |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48154186 |
aaactcgaatcaaccgcctcatatcagaacaccctgtcatcatcttcacccgatcctcctcatgctgcatgtgccatgtcatgaggaatctcctcttcac |
48154087 |
T |
|
| Q |
195 |
catcggcgttcatcccaccgttatccaattggatgacaacgagatccccgccgtccccaccacctccgatcactctctcactccggctgctttcatcggc |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
48154086 |
catcggcgttcatcccaccgttatccaattggatgacaacgagatccccgccgtccccaccacctccgatcactctctcactcccgctgctttcatcggc |
48153987 |
T |
|
| Q |
295 |
ggtatctgcatcggtggcttggagtcccttgttgctcttcatctcac |
341 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
48153986 |
ggtatctgcatcggtggcttggagtcccttgttgctcttcatgtcac |
48153940 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 46; Significance: 3e-17; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 93 - 240
Target Start/End: Original strand, 4109283 - 4109427
Alignment:
| Q |
93 |
agaaactcgaatcaaccgcctcatatcagaacaccctgtcatcatcttcacccgatcctcctcatgctgcatgtgccatgtcatgaggaatctcctcttc |
192 |
Q |
| |
|
|||||| || ||| |||| |||||||||||||| || || ||||||||||| || ||||| | |||||||||| |||||||||| ||| || |||| | |
|
|
| T |
4109283 |
agaaacacgcatccaccgtctcatatcagaacatccagttatcatcttcacacgttcctctt---gctgcatgtgtcatgtcatgaagaagcttctctcc |
4109379 |
T |
|
| Q |
193 |
accatcggcgttcatcccaccgttatccaattggatgacaacgagatc |
240 |
Q |
| |
|
||||| || ||| |||||||||| ||| |||| || |||||||||||| |
|
|
| T |
4109380 |
accataggtgttaatcccaccgtcatcgaattagacgacaacgagatc |
4109427 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University