View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11982_low_25 (Length: 280)
Name: NF11982_low_25
Description: NF11982
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11982_low_25 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 12 - 266
Target Start/End: Original strand, 41922971 - 41923225
Alignment:
| Q |
12 |
agagagagatgtctcatttcagagagaacaagttgaagaatgacagggatggagacggggaggattaagagtagagattacaatggatattcacgggaag |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41922971 |
agagagagatgtctcatttcagagagaacaagttgaaaaatgacagggatggagacggggagaattaagagtagagattacaatggatattcacgggaag |
41923070 |
T |
 |
| Q |
112 |
caaagtattcatcggctactcacttatgaaataaaattgatattattgtcaacttcgtattagtctttgttgatgtccgttagatgggtattttacaaat |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
41923071 |
caaagtattcatcggctactcacttatgaaataaaattgatattattgtcaacttcgtattagtccttgttgatgtccgttagatgggtattttacaaat |
41923170 |
T |
 |
| Q |
212 |
tttgaatcatcatcacaaacgtacgtccatcaaactctaaaataggtggttcttg |
266 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41923171 |
tttgaatcatcatcacaaacgtacgtccatcaaactctaaaataggtggttcttg |
41923225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University