View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11982_low_30 (Length: 235)
Name: NF11982_low_30
Description: NF11982
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11982_low_30 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 17 - 213
Target Start/End: Complemental strand, 45361974 - 45361778
Alignment:
| Q |
17 |
gacgttggcccaaatggtgagagcaagtaagacgataatcttttgaagtgtgtctgcgacgaggaagcgtgtgttcattttgtaaggattgttagaggca |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45361974 |
gacgttggcccaaatggtgagagcaagtaagacgataatcttttgaagtgtgtctgcgacgaggaagcgtgtgttcattttgtaaggattgttagaggca |
45361875 |
T |
 |
| Q |
117 |
atgaaatggaatgaaagtaaaggaactgcaaacagagcaaccaagcgattgatgccggagcattgatcgggagagaatatcttccaccatttcactg |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45361874 |
atgaaatggaatgaaagtaaaggaactgcaaacagagcaacgaagcgattgatgccggagcattgatcgggagagaatatcttccaccatttcactg |
45361778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 49; Significance: 4e-19; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 89 - 213
Target Start/End: Complemental strand, 25038722 - 25038598
Alignment:
| Q |
89 |
gttcattttgtaaggattgttagaggcaatgaaatggaatgaaagtaaaggaactgcaaacagagcaaccaagcgattgatgccggagcattgatcggga |
188 |
Q |
| |
|
||||||||||||||||||||| || || ||||||||||||||||| | ||||||||||| || ||||| || || ||||| || || |||||||| || |
|
|
| T |
25038722 |
gttcattttgtaaggattgtttgatgctatgaaatggaatgaaagaagtggaactgcaaagagtgcaacaaaacggttgattcctgaacattgatcaggt |
25038623 |
T |
 |
| Q |
189 |
gagaatatcttccaccatttcactg |
213 |
Q |
| |
|
|| ||||| ||||||||||| |||| |
|
|
| T |
25038622 |
gaaaatattttccaccattttactg |
25038598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University