View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11983_low_6 (Length: 321)
Name: NF11983_low_6
Description: NF11983
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11983_low_6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 23 - 273
Target Start/End: Complemental strand, 6234091 - 6233838
Alignment:
| Q |
23 |
atatatatataatacacacaaaagtcaataccacttatgaaacggttttagcggcgacgggggcgggattgagtggtgctcgaacggcggcg---ctgtc |
119 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
6234091 |
atatatatataatacacacaaaagtgaataccacttatgaaacggttttagcggcgacgggggcgggattgagtggtgctcgaacggcggcggcgctgtc |
6233992 |
T |
|
| Q |
120 |
ttcgtcgtcgggatcgtaatcagggttgagattgcgatcgatggcttgacgaccttgttcgaggcagggtttacaagctatctcgatagtgatccaacct |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6233991 |
ttcgtcgtcgggatcgtaatcagggttgagattgcgatcgatggcttgacgaccttgttcgaggcagggtttacaagctatctcgatagtgatccaacct |
6233892 |
T |
|
| Q |
220 |
agaatcactcctaccactgcgatcactgcaccggtgattgctcccatgatccct |
273 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6233891 |
agaatcactcctaccactgcgatcactgcaccggtgattgctcccatgatccct |
6233838 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University