View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11985_high_23 (Length: 223)
Name: NF11985_high_23
Description: NF11985
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11985_high_23 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 19 - 209
Target Start/End: Complemental strand, 5173922 - 5173732
Alignment:
| Q |
19 |
cataggtcctaggtttcaatccagctctgagaatgcagcagcgttaaaactcttaatggagagttgtatcaccctcgtgactctatttaactcgagggat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5173922 |
cataggtcctaggtttcaatccagctctgagaatgcagcagcgttaaaactcttaatggagagttgtatcaccctcgtgactctatttaactcgagggat |
5173823 |
T |
 |
| Q |
119 |
tagtctatatagttgcacgtgaaggatatccgatttacaacgataaataattatgtgcataggcttttgacatgttgttacttgtcattat |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5173822 |
tagtctatatagttgcacgtgaaggatatccgatttacaacgataaataattatgtgcataggcttttgacatgttgttacttgtcattat |
5173732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University