View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11985_high_24 (Length: 210)
Name: NF11985_high_24
Description: NF11985
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11985_high_24 |
 | |
|
| [»] scaffold2079 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold2079 (Bit Score: 102; Significance: 8e-51; HSPs: 1)
Name: scaffold2079
Description:
Target: scaffold2079; HSP #1
Raw Score: 102; E-Value: 8e-51
Query Start/End: Original strand, 1 - 114
Target Start/End: Original strand, 283 - 396
Alignment:
| Q |
1 |
agcctactatacttaatcgggtagaatttttctcatattgcgtaccccgaatccgcccataggtgaccaacataaattgcaaattatgggactatcctca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||| |||| |
|
|
| T |
283 |
agcctactatacttaatcgggtagaatttttctcatattgcgtaccccgaatccgcccataggtgaccaacatgaattgcaaattatgcgactatgctca |
382 |
T |
|
| Q |
101 |
aatgcacaagttgg |
114 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
383 |
aatgcacaagttgg |
396 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 53; Significance: 1e-21; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 29 - 113
Target Start/End: Original strand, 6242124 - 6242208
Alignment:
| Q |
29 |
tttctcatattgcgtaccccgaatccgcccataggtgaccaacataaattgcaaattatgggactatcctcaaatgcacaagttg |
113 |
Q |
| |
|
|||||||||||||||||| |||||||| ||||| |||| |||||| |||||||||||||| |||||| |||||||| |||||||| |
|
|
| T |
6242124 |
tttctcatattgcgtaccgcgaatccgtccatacgtgatcaacatgaattgcaaattatgtgactatgctcaaatgaacaagttg |
6242208 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University