View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11985_low_14 (Length: 285)
Name: NF11985_low_14
Description: NF11985
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11985_low_14 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 16 - 285
Target Start/End: Complemental strand, 24915979 - 24915731
Alignment:
| Q |
16 |
gacatcagttactccactatttgtaagtgaccttaactcagcctgtaaacttggtaaaaaatactgatgcggctactagaattgaccaaatgacatgttc |
115 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24915979 |
gacattagttactccactatttgtaagtgaccttaactcagcctgtaaactaggtaaaaaatactgatgcggctactagaattgaccaaatgacatgttc |
24915880 |
T |
 |
| Q |
116 |
tcagtgaccctttcggaaacaaaagcctcttgttacaaatcattgttatcttcaaacattgatttaggtagtctattctaacaacaaagcagttgtttaa |
215 |
Q |
| |
|
||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
24915879 |
tcagtgacccttt---------------------acatatcattgttatcttcaaacattgatttaggtagtctattctaacaacaaagtagttgtttaa |
24915801 |
T |
 |
| Q |
216 |
ttagtgaagagaaaatattttatgatctcaatgcacaagcagcacacacgtaaacttgcacaagcagtca |
285 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24915800 |
ttagtgaagagaaaatattttatgatctcaatgcacaagcagcacacacgtaaacttgcacaagcagtca |
24915731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University