View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11985_low_18 (Length: 250)
Name: NF11985_low_18
Description: NF11985
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11985_low_18 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 1 - 245
Target Start/End: Complemental strand, 7500168 - 7499924
Alignment:
| Q |
1 |
ccgctggaaaggtggaggagatcggttgtacgtgaggattgttgagtttggaatagagcgtatgaccggagaactggggaggcaagctggcattaatctc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7500168 |
ccgctggaaaggtggaggagatcggttgtacgtgaggattgttgtgtttggaatagagcatatgaccggagaactggggaggcaagctggcattaatctc |
7500069 |
T |
|
| Q |
101 |
gtgaatgcaattcaaaatggagagaggattatatttgattgaaaaggtttataccaattcttaaatatttcatttaaatctactaggttttcatggttag |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7500068 |
gtgaatgcaattcaaaatggagagaggattatatttgattgaaaaggtttataccaatttttaaatatttcatttaaatctactaggttttcatggttag |
7499969 |
T |
|
| Q |
201 |
aacaattgtggtaattggattggatgtgttttccttcttctctct |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
7499968 |
aacaattgtggtaattggattggatgtgttttacttcttcactct |
7499924 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University