View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11985_low_21 (Length: 239)
Name: NF11985_low_21
Description: NF11985
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11985_low_21 |
 |  |
|
| [»] scaffold2079 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr7 (Bit Score: 75; Significance: 1e-34; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 1 - 99
Target Start/End: Complemental strand, 6241847 - 6241749
Alignment:
| Q |
1 |
aacttgtgcgaatcaattcacaaaagtacaaagaacaggtacacaagtatcggtttaataattccattttgcaaataaaaatgaatgactttaatatta |
99 |
Q |
| |
|
||||||||||||||||||||||||||||| | |||| |||| |||||||||||||||||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
6241847 |
aacttgtgcgaatcaattcacaaaagtaccatgaaccggtagacaagtatcggtttaatatttccattttgcaaataaaaatgaatgactttaacatta |
6241749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 132 - 177
Target Start/End: Complemental strand, 6241581 - 6241536
Alignment:
| Q |
132 |
taaatttcttaggtgatagttttgcctgtgatagagactaattttt |
177 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6241581 |
taaatttcttaggtgatagttttgcctgtgatagagactaattttt |
6241536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 132 - 177
Target Start/End: Complemental strand, 6212654 - 6212609
Alignment:
| Q |
132 |
taaatttcttaggtgatagttttgcctgtgatagagactaattttt |
177 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
6212654 |
taaatttcttaggtgatagttttgcctgtgataaagactaattttt |
6212609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 4 - 49
Target Start/End: Complemental strand, 16723890 - 16723845
Alignment:
| Q |
4 |
ttgtgcgaatcaattcacaaaagtacaaagaacaggtacacaagta |
49 |
Q |
| |
|
||||||||| |||||||||||||||| | |||| |||||||||||| |
|
|
| T |
16723890 |
ttgtgcgaaccaattcacaaaagtaccacgaaccggtacacaagta |
16723845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold2079 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold2079
Description:
Target: scaffold2079; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 29
Target Start/End: Complemental strand, 31 - 3
Alignment:
| Q |
1 |
aacttgtgcgaatcaattcacaaaagtac |
29 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
31 |
aacttgtgcgaatcaattcacaaaagtac |
3 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University