View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11986_low_7 (Length: 233)
Name: NF11986_low_7
Description: NF11986
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11986_low_7 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 115; Significance: 1e-58; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 1 - 153
Target Start/End: Original strand, 3543857 - 3544008
Alignment:
| Q |
1 |
ggtcgaaggttatacccataagatgaataaagatagtaaattgtgtacataatagtcttgaagttattaagaggaatgtctttcctggtcttaa-ttttt |
99 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
3543857 |
ggtcgaaggttatacccataagatggataaagatagcaaattgtgtacataatagtcttgaagttattaagaggattgtctttcctggtcttaatttttt |
3543956 |
T |
 |
| Q |
100 |
taataatcctattactcgtaaaatttacattttcacattaaagcatttaattta |
153 |
Q |
| |
|
|||||||| ||||||||||||||||| ||||||||||||||||||||| |||| |
|
|
| T |
3543957 |
taataatcgtattactcgtaaaattt--attttcacattaaagcatttagttta |
3544008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University