View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11988_low_10 (Length: 239)
Name: NF11988_low_10
Description: NF11988
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11988_low_10 |
 |  |
|
| [»] scaffold0186 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0186 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: scaffold0186
Description:
Target: scaffold0186; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 17 - 230
Target Start/End: Original strand, 25000 - 25214
Alignment:
| Q |
17 |
tccttaattgtgatctaataaggagttatgaaactcgcttttgctctttattttctccaaataccttacaactcccatctcctaattgga-agcttgttg |
115 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| ||||| ||||||||||||||||||||| ||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
25000 |
tccttaattgtgatctaataaggagttgtgaaactcacttttactctttattttctccaaatacgttacaactcccatctcctagttggacagcttgttg |
25099 |
T |
 |
| Q |
116 |
aaactctagctgaaattgaatttcaaacaccaattatcaaggagatttcaccttattttacgagcctttattattctttttcttgattgccacttacatt |
215 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
25100 |
aaactctagctgaaattgaatttcaagcaccaattatcaaggagatttcaccatattttacgagcctttattattcattttcttgatttccacttacatt |
25199 |
T |
 |
| Q |
216 |
ttatatgtgtctgtg |
230 |
Q |
| |
|
|||||||||| |||| |
|
|
| T |
25200 |
ttatatgtgtttgtg |
25214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University