View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11988_low_9 (Length: 239)
Name: NF11988_low_9
Description: NF11988
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11988_low_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 4 - 219
Target Start/End: Original strand, 17970410 - 17970622
Alignment:
| Q |
4 |
gttcctgggcagaattgtttgctgctcacacctgcattttattggtatttcacaatataattataaatcaacatatatgatataaaaatagtattgaaaa |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||| |||||||||||||| |
|
|
| T |
17970410 |
gttcctgggcagaattgtttgctgctcacacctgcattttattggtatttcacactataat---aaatcaacatatatgatataataatagtattgaaaa |
17970506 |
T |
 |
| Q |
104 |
tcttgaattaaagaatatttttccttattaatatgtaacataccaagaaagaaaatagcaatgagcatggctgcaaggataaatttcagagaagccattg |
203 |
Q |
| |
|
|| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
17970507 |
tcatgaattaaagaatatttttgcttattaatatgtaacataccaagaaagaaaatagcaatgagcattgctgcaaggataaacttcagagaagccattg |
17970606 |
T |
 |
| Q |
204 |
agtcacttgttttagg |
219 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
17970607 |
agtcacttgttttagg |
17970622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University