View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11989_high_4 (Length: 438)
Name: NF11989_high_4
Description: NF11989
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11989_high_4 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 274; Significance: 1e-153; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 30 - 350
Target Start/End: Original strand, 43187970 - 43188280
Alignment:
| Q |
30 |
gaattcatattgtgacctccactgatatctttcaattcatgaagaaaaatggaatggaatacaatgagacgaaatttgagaggatttgattgtcgaaggt |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43187970 |
gaattcatattgtgacctccactgatatctttcagttcatgaagaaaaatggaatggaatacaatgagacgaaatttgagaggatttgattgtcgaaggt |
43188069 |
T |
|
| Q |
130 |
ctgtttttctcaacatcatcgttgttacaactagaaagcatttagtgactcttactgagctacttgtcttatatctcggtgctcaactgctggattttgt |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43188070 |
ctgtttttctcaacatcatcgttgttacaactagaaagcatttagtgactcttattgagctacttgtcttatatctcggtgctcaactgctgga------ |
43188163 |
T |
|
| Q |
230 |
gtattttttggtgattctttcatcagttagcgttcaataaaacatgttagcatcatttgttcctatttggaatccggatggatatagggatctagcttcc |
329 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43188164 |
----tttttggtgattctttcatcagttggcgttcaataaaacatgttagcatcatttgttcctatttggaatccggatggatatagggatctagcttcc |
43188259 |
T |
|
| Q |
330 |
attccaccacttctgaaatcc |
350 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
43188260 |
attccaccacttctgaaatcc |
43188280 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University