View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11990_high_15 (Length: 265)
Name: NF11990_high_15
Description: NF11990
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11990_high_15 |
 |  |
|
| [»] chr8 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 167; Significance: 2e-89; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 41 - 265
Target Start/End: Original strand, 13510823 - 13511043
Alignment:
| Q |
41 |
gtgattaccgcaataagtgtgaaaaaattgaagaaagagcaagacatatatacaaccatgttggtggaaccctcgccgccactgtcatcgcttgcgttga |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||| |
|
|
| T |
13510823 |
gtgattaccgcaataagtgtgaaaaaattgaaga----gcaagacatatatacaaccatgttggtggaaccctcaccgccactgtcatcacttgcgttga |
13510918 |
T |
 |
| Q |
141 |
cattgaagcaggctgccgcttcactatgtcgcttcaatttagtaatattctacaaatgggatgtagtaannnnnnnaggttatttgcttgattgagggca |
240 |
Q |
| |
|
||||||||||| ||||||||||||| |||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
13510919 |
cattgaagcagactgccgcttcactttgtcgcttcaatttagcaatattctacaaatgggatgtagtaatttttttaggttatttgcttgattgagggca |
13511018 |
T |
 |
| Q |
241 |
tcagttaaccttgcttcaatttcac |
265 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
13511019 |
tcagttaaccttgcttcaatttcac |
13511043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 41 - 265
Target Start/End: Original strand, 13600354 - 13600574
Alignment:
| Q |
41 |
gtgattaccgcaataagtgtgaaaaaattgaagaaagagcaagacatatatacaaccatgttggtggaaccctcgccgccactgtcatcgcttgcgttga |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||| |
|
|
| T |
13600354 |
gtgattaccgcaataagtgtgaaaaaattgaaga----gcaagacatatatacaaccatgttggtggaaccctcaccgccactgtcatcacttgcgttga |
13600449 |
T |
 |
| Q |
141 |
cattgaagcaggctgccgcttcactatgtcgcttcaatttagtaatattctacaaatgggatgtagtaannnnnnnaggttatttgcttgattgagggca |
240 |
Q |
| |
|
||||||||||| ||||||||||||| |||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
13600450 |
cattgaagcagactgccgcttcactttgtcgcttcaatttagcaatattctacaaatgggatgtagtaatttttttaggttatttgcttgattgagggca |
13600549 |
T |
 |
| Q |
241 |
tcagttaaccttgcttcaatttcac |
265 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
13600550 |
tcagttaaccttgcttcaatttcac |
13600574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 172 - 256
Target Start/End: Complemental strand, 17585551 - 17585467
Alignment:
| Q |
172 |
cttcaatttagtaatattctacaaatgggatgtagtaannnnnnnaggttatttgcttgattgagggcatcagttaaccttgctt |
256 |
Q |
| |
|
|||||||||| ||||||||| |||||||||| |||| ||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
17585551 |
cttcaatttaacaatattctatgaatgggatgtggtaatgtttgtaggttattttcttgattgagggcatcagttaaccttgctt |
17585467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University