View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11991_high_5 (Length: 237)

Name: NF11991_high_5
Description: NF11991
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11991_high_5
NF11991_high_5
[»] chr2 (1 HSPs)
chr2 (15-137)||(38883460-38883583)
[»] chr1 (1 HSPs)
chr1 (88-162)||(6083521-6083594)


Alignment Details
Target: chr2 (Bit Score: 112; Significance: 9e-57; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 112; E-Value: 9e-57
Query Start/End: Original strand, 15 - 137
Target Start/End: Complemental strand, 38883583 - 38883460
Alignment:
15 cagagactaaaaaggataataataactcaaatttagtaaggacgccggacaaataaagcaattcggaagctacacttatgaatagaatttcaaggcaatc 114  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38883583 cagagactaaaaaggataataataactcaaatttagtaaggacgccggacaaataaagcaattcggaagctacacttatgaatagaatttcaaggcaatc 38883484  T
115 acttggatag-gatggcttgctca 137  Q
    ||||||||||  ||||||||||||    
38883483 acttggatagatatggcttgctca 38883460  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 88 - 162
Target Start/End: Original strand, 6083521 - 6083594
Alignment:
88 acttatgaatagaatttcaaggcaatcacttggataggatggcttgctcagatggcctaggttggaggttgtctg 162  Q
    |||| |||||| | ||||||| || |||||||||||| |||||||| |||||||||| | |||||||||||||||    
6083521 acttttgaataaattttcaagacactcacttggatag-atggcttgttcagatggcccaagttggaggttgtctg 6083594  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University