View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11991_low_7 (Length: 237)
Name: NF11991_low_7
Description: NF11991
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11991_low_7 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 112; Significance: 9e-57; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 112; E-Value: 9e-57
Query Start/End: Original strand, 15 - 137
Target Start/End: Complemental strand, 38883583 - 38883460
Alignment:
| Q |
15 |
cagagactaaaaaggataataataactcaaatttagtaaggacgccggacaaataaagcaattcggaagctacacttatgaatagaatttcaaggcaatc |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38883583 |
cagagactaaaaaggataataataactcaaatttagtaaggacgccggacaaataaagcaattcggaagctacacttatgaatagaatttcaaggcaatc |
38883484 |
T |
|
| Q |
115 |
acttggatag-gatggcttgctca |
137 |
Q |
| |
|
|||||||||| |||||||||||| |
|
|
| T |
38883483 |
acttggatagatatggcttgctca |
38883460 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 88 - 162
Target Start/End: Original strand, 6083521 - 6083594
Alignment:
| Q |
88 |
acttatgaatagaatttcaaggcaatcacttggataggatggcttgctcagatggcctaggttggaggttgtctg |
162 |
Q |
| |
|
|||| |||||| | ||||||| || |||||||||||| |||||||| |||||||||| | ||||||||||||||| |
|
|
| T |
6083521 |
acttttgaataaattttcaagacactcacttggatag-atggcttgttcagatggcccaagttggaggttgtctg |
6083594 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University