View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11992_low_16 (Length: 379)
Name: NF11992_low_16
Description: NF11992
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11992_low_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 318; Significance: 1e-179; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 318; E-Value: 1e-179
Query Start/End: Original strand, 1 - 365
Target Start/End: Original strand, 41407741 - 41408106
Alignment:
| Q |
1 |
ttggtaataggatcgtggcactccaagtttggcctcaactttctcttttcgacttgatccgtttacaaggatcttttgtgcgcaactccattagaggtca |
100 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||| |
|
|
| T |
41407741 |
ttggtaataggatcgtggtactccaaatttggcctcaactttctcttttcgacttgatccgttgacaaggatcttttgtgtgcaactccattagaggtca |
41407840 |
T |
 |
| Q |
101 |
tatccttccccttattcctcataatggttacttgcacggagagcacagatcataggtaaacgtaattatcgagtctcactatgtcttag-cttatattga |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||| |||||||| | |
|
|
| T |
41407841 |
tatccttccccttattcctcataatggttacttgcacggagagcacaaatcataggtaaatgtaattatcgagtctcactatgtcttagacttatattta |
41407940 |
T |
 |
| Q |
200 |
gtatttgacaacccgcatcagtcctttactcagtttctcttgcatcgtttattcttcactcggctaaggagtttcctcgcctaactataattgtcaaatt |
299 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41407941 |
gtatttgacgacccacatcagtcctttactcagtttctcttgcatcgtttattcttcactcggctaaggagtttcctcgcctaactataattgtcaaatt |
41408040 |
T |
 |
| Q |
300 |
cggctagtaaggtaattatctttaggtgtaaacacaaattaatatactaatgagactatgcttcat |
365 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
41408041 |
cggctagtaaggtaattatctttaggtgtaaatacaaattaatatactaatgagactatgcttcat |
41408106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University