View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11992_low_19 (Length: 357)
Name: NF11992_low_19
Description: NF11992
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11992_low_19 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 106; Significance: 5e-53; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 106; E-Value: 5e-53
Query Start/End: Original strand, 26 - 195
Target Start/End: Complemental strand, 31644985 - 31644816
Alignment:
| Q |
26 |
atttatgtatttaagatttttgtggctagttcaatccttcttttttatgcaagcaaaataaagacattttattaattatattgtcataaatgcattcaag |
125 |
Q |
| |
|
||||||||||||||||||||| ||||||| |||||||||||||||| || ||||||||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
31644985 |
atttatgtatttaagatttttccagctagttttatccttcttttttatgtaaacaaaataaagaaatttcattaattatattgtcataaatgcattcaag |
31644886 |
T |
|
| Q |
126 |
aatataattggaaaccctacaaggagcataagataacgctgctcttgcaagagtatgagttctaccattt |
195 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||| | | ||||||||||||| |||| |||||||| |
|
|
| T |
31644885 |
aatgtaattggaaaccctacaaggagcataagataacaccgttcttgcaagagtacaagttttaccattt |
31644816 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University