View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11992_low_21 (Length: 329)
Name: NF11992_low_21
Description: NF11992
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11992_low_21 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 18 - 317
Target Start/End: Original strand, 36686029 - 36686333
Alignment:
| Q |
18 |
aatactaataatattacaacttaatatatttcttcaatcaatgattttatgannnnnnnnnnn-----atcatccggtctttccgaaggaactatattac |
112 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
36686029 |
aatactaataatattacagcttaatatatttcttcaatcaatgattttatgattttttttttttttttatcatccggtctttccgaaggaactatattac |
36686128 |
T |
|
| Q |
113 |
gatattatggaattttagattgagaagcgcttctcagtatacaagaaaagctcttgtcacgctactagttaattcattgaagcctgctcctttttgtatg |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36686129 |
gatattatggaattttagattgagaagcgcttctcagtatacaagaaaagctcttgtcacgttactagttaattcattgaagcctgctcctttttgtatg |
36686228 |
T |
|
| Q |
213 |
aagtgcaacacagaccgttcagcgagtgcttacctttggtcttgcttcttgtagaggtaattttagagatattttagttcattttgttggttgctttgtt |
312 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36686229 |
aagtgcaacacagacggttcagcgagtgcttacctttggtcttgcttcttgtagaggtaattttagagatattttagttcattttgttggttgctttgtt |
36686328 |
T |
|
| Q |
313 |
cttct |
317 |
Q |
| |
|
|||| |
|
|
| T |
36686329 |
gttct |
36686333 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University