View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11992_low_26 (Length: 305)
Name: NF11992_low_26
Description: NF11992
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11992_low_26 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 139; Significance: 9e-73; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 139; E-Value: 9e-73
Query Start/End: Original strand, 21 - 174
Target Start/End: Complemental strand, 400083 - 399929
Alignment:
| Q |
21 |
gatagggatgaaaatttaattggttttacttgtaagacggggcattgctacaattggtcatgcatgcctaacccc-gaaggtaccaagaaacaaacaaat |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
400083 |
gatagggatgaaaatttaattggttttacttgtaagacggggcattactacaattggtcatgcatgcctaacccccgaaggtaccaagaaacaaacaaat |
399984 |
T |
 |
| Q |
120 |
acaataatagtccatatgagacagattgatttgcgatgaaagcatcacttgggtt |
174 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
399983 |
acaataatagtccatatgagacagattgatttgggatgaaagcatcacttgggtt |
399929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 169 - 289
Target Start/End: Complemental strand, 399910 - 399790
Alignment:
| Q |
169 |
tgggttcatatgccattggcttgttatagtttggttgactttaaaacaagtttaaatttcaacgtcaaacacaaaaaataagttctttattttgtaagtg |
268 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
399910 |
tgggttcaaatgccattggcttgttatagtttggttgactttaaaacaagtttaaatttcaacgtcaaacacaaaaaagaagttctttattttgtaagtg |
399811 |
T |
 |
| Q |
269 |
aaagataaagtctatactttc |
289 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
399810 |
aaagataaagtctatactttc |
399790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University