View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11992_low_31 (Length: 263)
Name: NF11992_low_31
Description: NF11992
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11992_low_31 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 50 - 252
Target Start/End: Original strand, 39675627 - 39675829
Alignment:
| Q |
50 |
atcaatctccctgaactcctttctttcttttcattttctggatttcaaatccttcacttaacaagagagaaatggaagttcaacgccaaatatattctga |
149 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39675627 |
atcaatctccctgaactcctttctttcttttcattttctggatttcaaatccttcacttaacaagagagaaatggaagttcaacgccaaatatattctga |
39675726 |
T |
|
| Q |
150 |
tccctccagcaaaacaaagaagaaccaaaagcagcagaattcactgtcacaaacttcttcactttacttaacaaacacttttttcttcggtctctgcttc |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
39675727 |
tccctccagcaaaacaaagaagaaccaaaagcagcagaattcactgtcacaaacttcttcactttacttaacaaacacttttttcttcggtctcttcttc |
39675826 |
T |
|
| Q |
250 |
tcc |
252 |
Q |
| |
|
||| |
|
|
| T |
39675827 |
tcc |
39675829 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University