View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11992_low_36 (Length: 217)
Name: NF11992_low_36
Description: NF11992
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11992_low_36 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 96; Significance: 3e-47; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 106 - 209
Target Start/End: Complemental strand, 3351694 - 3351591
Alignment:
| Q |
106 |
atccttagaaatttgacatatattgctggaaatcttttgtaggtaaatataaaaaagttgacatctagtaattgaacaccatatctctttcttttcatct |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| | |
|
|
| T |
3351694 |
atccttagaaatttgacatatattgctggaaatcttttgtaggtaaatataaaaaagttgacatctagtaattgaacaacatatctctttcttttcattt |
3351595 |
T |
|
| Q |
206 |
ctct |
209 |
Q |
| |
|
|||| |
|
|
| T |
3351594 |
ctct |
3351591 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 23 - 105
Target Start/End: Complemental strand, 3351841 - 3351759
Alignment:
| Q |
23 |
gcctttgcatatatccctccttccacaattgtatgacaatgtgacctttgcatatattcctccttccacaaacttcacttctc |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3351841 |
gcctttgcatatatccctccttccacaattgtatgacaatgtgacctttgcatatattcctccttccacaaacttcacttctc |
3351759 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University