View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11992_low_37 (Length: 216)
Name: NF11992_low_37
Description: NF11992
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11992_low_37 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 1 - 202
Target Start/End: Complemental strand, 36362785 - 36362582
Alignment:
| Q |
1 |
aagagataaaaaattaccagaattaccgatttggtnnnnnnnntaacaaacacaagattaaagtaggacatattcttgcatataatattgattctttcac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36362785 |
aagagataaaaaattaccagaattaccgatttggtaaaaaaaataacaaacacaagattaaagtaggacatattcttgcatataatattgattctttcac |
36362686 |
T |
 |
| Q |
101 |
attttgtaaatgcacagtaa--acnnnnnnnactgctgtctaactaactgtggaaatttaacagctgagctattgggattcgatgattatattccaccct |
198 |
Q |
| |
|
|||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36362685 |
attttgtaaatgcacagtaatttttttttttactgttgtctaactaactgtggaaatttaacagctgagctattgggattcgatgattatattccaccct |
36362586 |
T |
 |
| Q |
199 |
atgc |
202 |
Q |
| |
|
|||| |
|
|
| T |
36362585 |
atgc |
36362582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University