View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11993_low_16 (Length: 201)
Name: NF11993_low_16
Description: NF11993
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11993_low_16 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 1 - 201
Target Start/End: Original strand, 44017043 - 44017237
Alignment:
| Q |
1 |
aaagagaagttattacttgtatctttgttatgctaaaaaagagtaagcaaaagaacaaagaggtaacactaatattttccatttttgattgtgaaaatgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44017043 |
aaagagaagttattacttgtatctttgttatgctaaaaaagagtaagcaaaagaacaaagaggtaacactaatattttccatttttgattgtgaaaatgg |
44017142 |
T |
 |
| Q |
101 |
tggctttacttggagtcggagattaatgtagaagatgagggtgaaggtgaaggtgaaggtaataaaagactactagtttaggagagcacatgcatgatgc |
200 |
Q |
| |
|
|| ||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44017143 |
tgactttacttggagttggagattaatgtagaagatgagggtgaaggtgaaggtg------ataaaagactactagtttaggagagcacatgcatgatgc |
44017236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University