View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11994_high_6 (Length: 337)
Name: NF11994_high_6
Description: NF11994
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11994_high_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 313; Significance: 1e-176; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 313; E-Value: 1e-176
Query Start/End: Original strand, 8 - 324
Target Start/End: Complemental strand, 33593076 - 33592760
Alignment:
| Q |
8 |
attgttacttagaagaagaaaggtgaacactgaaccatagatagaagagaaaacatgttgaaactaattggaagaaaatcaagttggataccctccaatt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33593076 |
attgttacttagaagaagaaaggtgaacactgaaccatagatagaagagaaaacatgttgaaactaattggaagaaaatcaagttggataccctccaatt |
33592977 |
T |
|
| Q |
108 |
tactgttaagaagagaattgtgtttgggtgcccttcctaatggcggagccatggaacacttgatcactcaacttcaatctcatgttcataaggttcttgc |
207 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33592976 |
tattgttaagaagagaattgtgtttgggtgcccttcctaatggcggagccatggaacacttgatcactcaacttcaatctcatgttcataaggttcttgc |
33592877 |
T |
|
| Q |
208 |
tggtggtggacccgaagctgtcaagaggaataatagtagaaataaacttctacccagagaaagaattgatcgtcttcttgatcctggttcttccttcctt |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33592876 |
tggtggtggacccgaagctgtcaagaggaataatagtagaaataaacttctacccagagaaagaattgatcgtcttcttgatcctggttcttccttcctt |
33592777 |
T |
|
| Q |
308 |
gagctttcacaggttct |
324 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
33592776 |
gagctttcacaggttct |
33592760 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University