View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11995_low_6 (Length: 241)
Name: NF11995_low_6
Description: NF11995
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11995_low_6 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 19 - 241
Target Start/End: Complemental strand, 40285587 - 40285365
Alignment:
| Q |
19 |
ctaattggttagtattcttgttgttaaggtggttttgatggatttattttttgcgggaggcgtctcttactgtttggctgctgctgctgttaactttttc |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
40285587 |
ctaattggttagtattcttgttgttaaggtggttttgatggatttattttttgcgggaggcgtttcttactgtttggctgctgctgctgttaactttttc |
40285488 |
T |
 |
| Q |
119 |
aacagagacaatgtcaggtatcactgcaatgtcattagctagtgccgttactttccatataacgttttcttctttgttattgtaatcattattttaattt |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40285487 |
aacagagacaatgtcaggtatcactgcaatgtcattagctagtgccgttactttccatataacgttttcttctttgttattgtaatcattattttaatta |
40285388 |
T |
 |
| Q |
219 |
ttgtacaggcatgtggaaactct |
241 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
40285387 |
ttgtacaggcatgtggaaactct |
40285365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University