View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11996_high_3 (Length: 242)
Name: NF11996_high_3
Description: NF11996
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11996_high_3 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 134; Significance: 7e-70; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 1 - 228
Target Start/End: Original strand, 38981502 - 38981714
Alignment:
| Q |
1 |
atatgtatatattgatatgatatatcgatgtgattatttgttcatatctacaaaagaggagagtatattgtgctcttttcttatcactt--tctcttttt |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
38981502 |
atatgtatatattgatatgatatatcgatgtgattatttgttcatatctacaaaagaggagagtatattgtgctcttttcttatcactttctctcttttt |
38981601 |
T |
 |
| Q |
99 |
aatggccacttagagtgttgtcctctccaaatgtattttgtggggaaagagaatgataggggccttaaagcataatatatgatgatcatactaataagtt |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||| | |||||||||||||||||||||||||||||||||| |
|
|
| T |
38981602 |
aatggccacttagagtgttgtcctctccaaatgtattttgttaccaaaaa---------------aaaagcataatatatgatgatcatactaataagtt |
38981686 |
T |
 |
| Q |
199 |
ctgtttcataaactgacaagctttattcat |
228 |
Q |
| |
|
||||||| ||||||||||||||||||||| |
|
|
| T |
38981687 |
ctgtttc--aaactgacaagctttattcat |
38981714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University