View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11996_low_1 (Length: 284)
Name: NF11996_low_1
Description: NF11996
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11996_low_1 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 34 - 277
Target Start/End: Original strand, 37879925 - 37880161
Alignment:
| Q |
34 |
ggtgcgtggcagatccggatttgttgagagaacaacaaccttcgacgacgccatgcctagtttataggagagtttgttttgtttgttcagcttcggcttc |
133 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37879925 |
ggtgcgtggcagatccggatttgttgagagaacaacaaccttcgatgacgccatgcctagtttataggagagtttgttttgtttgttcagcttcggcttc |
37880024 |
T |
|
| Q |
134 |
ggcttcaaccctaagaaaagattcagaagcaatagcacaacaatgaaacaatagctatggcctttacttgagtttggatttttaagaattaagattaata |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
37880025 |
ggcttcaaccctaagaaaagattcagaagcaatagcacaacaatgaaacaatagctatggcctttacttgagtttggattt-------ttaagattaata |
37880117 |
T |
|
| Q |
234 |
atcacatgcatgcaaatcctttatatagctaccctttcttctct |
277 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37880118 |
atcacatgcatgcaaatcctttatatagctaccctttcttctct |
37880161 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University