View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11997_low_4 (Length: 337)
Name: NF11997_low_4
Description: NF11997
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11997_low_4 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 99 - 332
Target Start/End: Complemental strand, 15643742 - 15643509
Alignment:
| Q |
99 |
ctccaaattttgatctttctatcagctgaacctgtataaacaaccccagaagatgaaacaacgattgcattgattgcatcttcatgtgcatttttcactg |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
15643742 |
ctccaaattttgatctttctatcagctgaacctgtataaacaaccccagaagatgaaacaacgattgcattgattgcatcttcatgtgcacttttcactg |
15643643 |
T |
|
| Q |
199 |
actctaaacacttgaaatctgaaactctccaaattttgaatgttctatcccacgaagccgagtaaagaaacagtccatctttcgaaacagcaagagaaga |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
15643642 |
actctaaacacttgaaatctgaaactctccaaattttgaatgttctatcccacgaagccgagtaaagaaacaatccatctttcgaaacagcaagagaaga |
15643543 |
T |
|
| Q |
299 |
aacagcatcaatatgattcacccatgtatacttc |
332 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
15643542 |
aacagcatcaatatgattcacccatgtatacttc |
15643509 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University