View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11998_low_4 (Length: 340)
Name: NF11998_low_4
Description: NF11998
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11998_low_4 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 282; Significance: 1e-158; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 282; E-Value: 1e-158
Query Start/End: Original strand, 14 - 319
Target Start/End: Original strand, 5053585 - 5053890
Alignment:
| Q |
14 |
agcagcacagaaaaagcgctcatttcacttgtttgcatcacagaatttgaatcaatttctgaaaactatacaactactattgtcccttgacggtgacaaa |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
5053585 |
agcagcacagaaaaagcgctcatttcacttgttagcatcacagaatttgaatcaatttctgaaaactatacaactactattgtccctcgacggtggcaaa |
5053684 |
T |
|
| Q |
114 |
actaatactaccaactatagattatatatagtggttctagttatgttgcaaacctttatattgcagaaaaatgcaggaataagatgtcaaaattgcggtt |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
5053685 |
actaatactaccaactatagattatatatagtggttctagttacgttgcaaacctttatattgcagaaaaatgcgggaataagatgtcaaaattgcggtt |
5053784 |
T |
|
| Q |
214 |
gcaatactgttgtggagactttaaaatcccttatattacagtggcaatactgttgcggaggcttcaaaatcccttatattaccgtggcaatactgttgcg |
313 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5053785 |
gcaatactgttgtggagactttaaaatcccttatattacagtggcaatactgttgtggaggcttcaaaatcccttatattaccgtggcaatactgttgcg |
5053884 |
T |
|
| Q |
314 |
gagact |
319 |
Q |
| |
|
|||||| |
|
|
| T |
5053885 |
gagact |
5053890 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 214 - 285
Target Start/End: Original strand, 5053828 - 5053899
Alignment:
| Q |
214 |
gcaatactgttgtggagactttaaaatcccttatattacagtggcaatactgttgcggaggcttcaaaatcc |
285 |
Q |
| |
|
||||||||||||||||| ||| ||||||||||||||||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
5053828 |
gcaatactgttgtggaggcttcaaaatcccttatattaccgtggcaatactgttgcggagacttcaaaatcc |
5053899 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University