View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11999_high_1 (Length: 536)
Name: NF11999_high_1
Description: NF11999
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11999_high_1 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 442; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 442; E-Value: 0
Query Start/End: Original strand, 1 - 526
Target Start/End: Complemental strand, 1223636 - 1223105
Alignment:
| Q |
1 |
tgtcggatcggggcgggctaatgctgttgatccaccgtaattaggatcttggacccaccatagtgctaaaatgtagcggtgctattgttacatgatgcat |
100 |
Q |
| |
|
|||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
1223636 |
tgtcggataggggcgggctaaaactgttgatccaccgtaattaggatcttggacccaccatagcgctaaaatgtagtggtgctattgttacatgatgcat |
1223537 |
T |
|
| Q |
101 |
tatttcgagtgaaatgttgtcgaatagcagctatagaggcgcaatagcgtgtaatgtagtttgaacaaactattgttttttgtgatctgcgattgacaac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
1223536 |
tatttcgagtgaaatgttgtcgaatagcagctatagaggcgcaatagcgtgtaatgtagtttgatcaaactattgttttttgtgatctgcgattgacaac |
1223437 |
T |
|
| Q |
201 |
acttgttattggattaatttcttgagtcggttgtgcaacatcggtttcttttttacggagtagggctggcttaccttccaaatatgtgactctaggaatc |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
1223436 |
acttgttattggattaatttcttgagtcggttgtgcaacatcggtttcttttttacggagtagggctggc-taccttccaaatatgtgactctaggaatc |
1223338 |
T |
|
| Q |
301 |
aaattaagggcatcgagttggagcaactctttatgttggtgatt-------ttgatacttttctttctttatatatgatggaatgtaattgaatttgnnn |
393 |
Q |
| |
|
||||||||||||||| ||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1223337 |
aaattaagggcatcgtgttggggcaactctttatgttggtgattttgatacttgatacttttctttctttatatatgatggaatgtaattgaatttgttt |
1223238 |
T |
|
| Q |
394 |
nnnngtgcagctgaaatggtgagaagacaggctttgtttccaggggattctgaattccagcagattctgaacatattcaagtatatcaaactcacttttt |
493 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
1223237 |
ttttgtgcagctgaaatggtgagaagacaggctttgtttccaggggattctgaattccagcagcttctgaacatattcaagtatatcaaactcacttttt |
1223138 |
T |
|
| Q |
494 |
aataccttttctgattcaagtatattgcttctt |
526 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
1223137 |
aataccttttctgattcaagtatattgcttctt |
1223105 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University