View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1199_high_106 (Length: 349)
Name: NF1199_high_106
Description: NF1199
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1199_high_106 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 274; Significance: 1e-153; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 42 - 339
Target Start/End: Complemental strand, 24062011 - 24061714
Alignment:
| Q |
42 |
ttgggttgtcttcgtgatgcattgatttgtctgcatatttcatcccaagtaaatggactttattctcagacttttttaccatgtttattgctcctttttg |
141 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
24062011 |
ttgggttgtcttcgtgatgcattgatttgtctgcatatttcatcccaagtaaatggacttaattctcagacttttctaccatgtttattgctcctttttg |
24061912 |
T |
 |
| Q |
142 |
tagtgttgtagcgaacaatctacattggactgctccccaaaagttacggtagtcgatgatggcttcaatgtttttgataggctcgtctagatcagtggtt |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24061911 |
tagtgttgtagcgaacaatctacattggaccgctccccaaaagttattgtagtcgatgatggcttcaatgtttttgataggctcgtctagatcagtggtt |
24061812 |
T |
 |
| Q |
242 |
ctatcgtatggatatatttgtggaggcatctccaagcatgtttgaatgcacgcttcttgaattctccttgtgagtggaccttgaggaccatgttcatc |
339 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24061811 |
ctatcgtatggatatatttgtggagacatctccaagcatgtttgaatgcacgcttcttgaattctccttgtgagtggaccttgaggaccatgttcatc |
24061714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University