View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1199_high_115 (Length: 332)
Name: NF1199_high_115
Description: NF1199
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1199_high_115 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 277; Significance: 1e-155; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 30 - 322
Target Start/End: Original strand, 2181050 - 2181342
Alignment:
| Q |
30 |
attacaacatgtccacttttgcagatgcattgcactgtgaatgagccataccatttcttcttggactcagtatgatggtagaaaatgttggcagttctaa |
129 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
2181050 |
attacaacatgtctacttttgcagatgcattgcacagtgaatgagccataccatttcttcttggactgagtatgatggtagaaaatgttggcagttctaa |
2181149 |
T |
|
| Q |
130 |
gcattaccttatcagctccaacttcaaattatggcctttcttcaaactttctcattgcccttgccaaatattcccctaagcttgcgttgtcgcctaattc |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2181150 |
gcattaccttatcagctccaacttcaaattatggcctttcttcaaactttctcattgcccttgccaaatattcccctaagcttgcgttgtcgcctaattc |
2181249 |
T |
|
| Q |
230 |
ttcattcagctcccttgcttgggtgactttgagtttcggtgatattggcgactttgtttatatttggcttaattgtacttttggccccctatg |
322 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
2181250 |
ttcattcagctcccttgcttgggtgactttgagtttcggtgatattggcgactttgtttatatttggcttaattgcacttttggccccctatg |
2181342 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 286 - 322
Target Start/End: Original strand, 10730511 - 10730547
Alignment:
| Q |
286 |
tttatatttggcttaattgtacttttggccccctatg |
322 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
10730511 |
tttatttttggcttaattgtacttttggccccctatg |
10730547 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.0000001; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 292 - 321
Target Start/End: Original strand, 25693898 - 25693927
Alignment:
| Q |
292 |
tttggcttaattgtacttttggccccctat |
321 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
25693898 |
tttggcttaattgtacttttggccccctat |
25693927 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 292 - 320
Target Start/End: Complemental strand, 10332272 - 10332244
Alignment:
| Q |
292 |
tttggcttaattgtacttttggcccccta |
320 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
10332272 |
tttggcttaattgtacttttggcccccta |
10332244 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University